Chimie

Une pratique

Une pratique


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Un gène ribosomique est souvent utilisé comme standard interne pour la PCR en temps réel, dont l'expression est plus ou moins inchangée - le gène L27, qui code pour une protéine de la sous-unité 60S du ribosome.

tâche

Veuillez calculer la température de fusion du premier apprêt.

Amorce Fw AAAGCCGTCATCGTGAAGAAC : °C

Réinitialiser Évaluer Afficher la solution
tâche

Veuillez calculer la température de fusion du deuxième apprêt.

Amorce Rv GCTGTCACTTTCCGGGGATAG : °C

Réinitialiser Évaluer Afficher la solution
Noter
Pour rappel : La formule est température de fusion en °C = (A + T) 2 + (G + C) 4


Vidéo: Minun Logbullet - Lisävarusteet uutuutena hidas vaihde (Mai 2022).